The Deport Times (Deport, Tex.), Vol. 40, No. 47, Ed. 1 Thursday, December 23, 1948

The Deport Times (Deport, Tex.), Vol. 40, No. 47, Ed. 1 Thursday, December 23, 1948: Searching Inside

We Found:

11 results that matched your query.

Sequence: 1 (standard view) | zoom view

... Editorial Column. Clam A Katin* University of Illinois. N. E. T. Press Aas’n Award Best Set Ads VQLUMK XL... DEPORT, LAMAR COUNTY, TEXAS, THURSDAY, DECEMBER 23, 1948 TWENTY PAGES—THREE SECTIONS NUMBER 47 J3r W •... Control Income Tax Due ACA Committee Named Monday Lamar County Agricultural Conservation committee... made in cooperation with the Farmers Home Administration in Lamar County, the fifth in the 16-county... rate is $1.50 a year in Lamar and Rs^j River; counties. Sent elsewhere, the prioe la $100 a j ye- FtJE

Sequence: 14 (standard view) | zoom view

... contest, involving a (bequest of a million and a quarter dollars to the University of Texas, had resulted... Thompson had been elected a faculty member of the Vanderbilt University of Religion ft Nashville, Tenn. Joe... minute with one hand, as he had only one hand. Lamar County had voted $150,- COO in bonds to continue WPA

Sequence: 11 (standard view) | zoom view

... by Lamar County Draft Board No. 82 from selective service headquarters. It is said that the finest and most... saw East Lamar trounce West Lamar, and Chicota take a forfeit from Central. liristmas W V>1948... of Lamar County It’s a very pleasant, cheering custom to renew friendly associations during the Yuletide

Sequence: 10 (standard view) | zoom view

... they nMbd without a card A total of 50.319 bales of cotlon bad been ginned in Lamar County prior to Nov. 14... (SMSKSKSKSKSKSHWI been elected captain of the Trinity University basketball team Vitapia>ne equipment, which made

Sequence: 15 (standard view) | zoom view

... sister, Mr. and Mrs. Leonard Hutchins at Emerson. The boys and girls of East Lamar school played ball... last week at Roxton. The boys of East Lamar won, but the East Lamar girls were defeated. Mr. and Mrs

Sequence: 16 (standard view) | zoom view

... second-claw mall mater, Feb. 10. 1009. ~suBSCRipnofThRicK In Lamar and Red River Counties 91.90 a Year Dutaide... Lamar and Red River Counties 92.00 a Year INVARIABLY IN ADVANCE For You and Yours at this Delightful

Sequence: 7 (standard view) | zoom view

...! SPORTING GOODS t 135 Lamar—PARIS Telephone 629 witatataaatatatataaaatagaaiaataaaaagaaauaMaa Advertise men

Sequence: 17 (standard view) | zoom view

... areauthorized Hudson Dealers for Lamar and Red River Counties. HUDSON OWNERS—Our stock of parts and accessories

Sequence: 13 (standard view) | zoom view

... and PROSPERITY GOREE GREENHOUSES 2464 E. Cherry Flower Store 104 Lamar PARIS Mr. and Mrs. Frank Lee of Deport

Sequence: 5 (standard view) | zoom view

.... Ginning figures prior to Dec. 1 were: Lamar $35,480; Red River 21,219; Titus 7,341. A county wide rat

Sequence: 20 (standard view) | zoom view

... Trinity University, San Antonio, with his parents, Mr and Mis W K. Read; Loy E Haves from Baylor... University with his father, L E Hayes and Mrs. Hayes; Jimmie Bill Evans from Oklahoma University. Norman. Ok... is a graduate of Deport High School and Baylor University. Her husband is a former student of Hillsboro High

Improving Results

Enclose phrases in quotation marks.
Use alternate spellings.
Limit or remove special characters and punctuation.

Unexpected/Odd Results?

When this item was originally scanned, we used Optical Character Recognition (OCR) technology to "read" and save text embedded in the image. OCR is not fool-proof, however. While the overall quality of the OCR results is generally good, the results may vary depending on legibility of the original materials.